Top » Catalog » SNPs » YP258

$18.00

YP258
[YP258]

YP258
hg38 Position: ChrY:16649945..16649945
Ancestral: T
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a1a
Comments: .
Forward Primer: YP258_F ATTTTAATGGGAATTCTGTTTAATAGG
Reverse Primer: YP258_R AATAGGAAATTCTCAATGCTTATCTATATG
Reviews

Customers who bought this product also purchased
Z93
Z93
M458
M458
Y51378
Y51378
Z282
Z282
L1029
L1029
Y166631
Y166631
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies