Top » Catalog » SNPs » Y4376

$18.00

Y4376
[Y4376]

Y4376
hg38 Position: ChrY:19058647..19058647
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Probably phylo-equivalent to YP331
Forward Primer: Y4376_F GAGTAGCTAGGATTACAGGCATGTG
Reverse Primer: Y4376_R GTCTTTACACAATCCTGCGTGT
Reviews

Customers who bought this product also purchased
M343
M343
BY79500
BY79500
M9
M9
Z91
Z91
M168
M168
M458
M458
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies