Top » Catalog » SNPs » A2501

$18.00

A2501
[A2501]

A2501
hg38 Position: ChrY:13466760..13466760
Ancestral: A
Derived: G
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > S658 > S660
Forward Primer: A2501_F TGGGAAGCACCCATTTTATG
Reverse Primer: A2501_R GGGCAACACTCTGTCTCAAAG
Reviews

Customers who bought this product also purchased
YP4685
YP4685
BY35727
BY35727
FT410057
FT410057
BY35731
BY35731
DF104
DF104
BY81963
BY81963
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies