Top » Catalog » SNPs » FT14506

$18.00

FT14506
[FT14506]

FT14506
hg38 Position: ChrY:15387752..15387752
Ancestral: G
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Bellow PH908
Forward Primer: FT14506_F GAGGTCTAGGCCTTGGTGC
Reverse Primer: FT14506_R CTAATAATTGGTCTGCTCAAATGC
Reviews

Customers who bought this product also purchased
FT34699
FT34699
BY170650
BY170650
A493
A493
FT177529
FT177529
A8740
A8740
A811
A811
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies