Top » Catalog » SNPs » FGC9583

$18.00

FGC9583
[FGC9583]

FGC9583
hg38 Position: ChrY:12853824..12853824
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below P58 > FGC11 > Y12361
Forward Primer: FGC9583_F CCATCTTCTGCATCAATCACAG
Reverse Primer: FGC9583_R TTTCAGGCAGAATTAGGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies