Top » Catalog » SNPs » FGC90325

$18.00

FGC90325
[FGC90325]

FGC90325
hg38 Position: ChrY:14170185..14170185
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2019)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: FGC90325_F GTAGCACCAAAGCACCAAAATAC
Reverse Primer: FGC90325_R TGAGGCGAAGTCTCGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies