Top » Catalog » SNPs » FGC9941

$18.00

FGC9941
[FGC9941]

FGC9941
hg38 Position: ChrY:16489313..16489313
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Kohanim subclades of J1. downstream L147.1
Forward Primer: FGC9941_F GGGAAAACATGAAGAAAGACAG
Reverse Primer: FGC9941_R AAACTTCAGGGGCTGGTTG
Reviews

Customers who bought this product also purchased
ZS2374
ZS2374
Y13968
Y13968
Y142158
Y142158
ZS10441
ZS10441
Y5409
Y5409
ZS11214
ZS11214
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies