Top » Catalog » SNPs » M172

$19.00

M172
[M172]

M172
hg38 Position: ChrY:12857709..12857709
Ancestral: T
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2
Comments: DFFRYEx45
Forward Primer: M172_F GAGCCAGATGACCAGGATG
Reverse Primer: M172_R GCAAATAGCAAAAGGGGGTAG
Reviews

Customers who bought this product also purchased
Y5435
Y5435
Z1164
Z1164
PF6748
PF6748
FT122165
FT122165
Z841
Z841
CTS6122
CTS6122
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies