Top » Catalog » SNPs » Y7708

$18.00

Y7708
[Y7708]

Y7708
hg38 Position: ChrY:16615949..16615949
Ancestral: C
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Downstream L26 > PF5088 > PF5125 > Z2227 > Z6065.
Forward Primer: Y7708_F TGGTGAGTGTGGTGTCCAAC
Reverse Primer: Y7708_R GTGGTGATCCAGCATGTGAC
Reviews

Customers who bought this product also purchased
Z27932
Z27932
Z7515
Z7515
FGC15772
FGC15772
J2a-L24 Panel
J2a-L24 Panel
Y89588
Y89588
BY8
BY8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies