Top » Catalog » SNPs » Z2227

$18.00

Z2227
[Z2227]

Z2227
hg38 Position: ChrY:19295380..19295380
Ancestral: T
Derived: C
Reference: Bonnie Schrack (2012)
ISOGG Haplogroup: J2a1
Comments: derived downstream of L26; in M319 and in M67
Forward Primer: Z2227_F TCCCACAGCTGATAGTGCTG
Reverse Primer: Z2227_R TTGCATAGTCCCAGGGTGTC
Reviews

Customers who bought this product also purchased
FGC21373
FGC21373
L227
L227
Y5178
Y5178
Y5501
Y5501
Y5168
Y5168
FGC19515
FGC19515
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies