Top » Catalog » SNPs » FGC11674

$18.00

FGC11674
[FGC11674]

FGC11674
hg38 Position: ChrY:13371021..13371021
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c1 (not listed)
Comments: Branch point Irish Maolain to Scotland
Forward Primer: FGC11674_F CGAGGTGGCATATGTCTGTC
Reverse Primer: FGC11674_R TACGGGAAGAGCTGTCAGTG
Reviews

Customers who bought this product also purchased
Z306
Z306
FGC11660
FGC11660
Z18
Z18
FGC11662
FGC11662
L48
L48
DF96
DF96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies