Top » Catalog » SNPs » L51

$18.00

L51
[L51]

L51
hg38 Position: ChrY:8634195..8634195
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1
Comments: Aka M412/PF6536/S167
Forward Primer: L51_F GCTGAACAGGTGCTTCATTG
Reverse Primer: L51_R TAGGCCAATGAGGAACACGA
Reviews

Customers who bought this product also purchased
L11
L11
Y167401
Y167401
S1194
S1194
FGC4133
FGC4133
DF41
DF41
FGC32795
FGC32795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies