Top » Catalog » SNPs » FGC5

$18.00

FGC5
[FGC5]

FGC5
hg38 Position: ChrY:16101147..16101147
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
J1-FGC5 Panel
J1-FGC5 Panel
Y171687
Y171687
BY189399
BY189399
FT50816
FT50816
ZS10535
ZS10535
ZS9106
ZS9106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies