Top » Catalog » SNPs » FGC5

$18.00

FGC5
[FGC5]

FGC5
hg38 Position: ChrY:16101147..16101147
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
FGC4316
FGC4316
FGC48130
FGC48130
ZS6421
ZS6421
FGC38706
FGC38706
FGC1729
FGC1729
ZS4717
ZS4717
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies