Top » Catalog » SNPs » FGC5

$18.00

FGC5
[FGC5]

FGC5
hg38 Position: ChrY:16101147..16101147
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
FGC8712
FGC8712
ZS10072
ZS10072
ZS9829
ZS9829
P56
P56
ZS4753
ZS4753
A12919
A12919
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies