Top » Catalog » SNPs » YP1702

$18.00

YP1702
[YP1702]

YP1702
hg38 Position: ChrY:17104305..17104305
Ancestral: G
Derived: C
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a1a (not listed)
Comments: Below Z280 > CTS1211 > YP340 > P278.2
Forward Primer: YP1702_F AATGTGTGGGTTTTAATTTATTCATTC
Reverse Primer: YP1702_R TTTCAGTATGTTGGCCAGTCTG
Reviews

Customers who bought this product also purchased
Y136297
Y136297
Y42285
Y42285
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies