Top » Catalog » SNPs » A185

$18.00

A185
[A185]

A185
hg38 Position: ChrY:15439022..15439022
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A185_F CAGCTCCCCCTGTACAAGTTAC
Reverse Primer: A185_R GCTGACCTTGCTGTGCTG
Reviews

Customers who bought this product also purchased
A178
A178
A166
A166
A184
A184
A172
A172
A190
A190
A177
A177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies