Top » Catalog » SNPs » A185

$18.00

A185
[A185]

A185
hg38 Position: ChrY:15439022..15439022
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A185_F CAGCTCCCCCTGTACAAGTTAC
Reverse Primer: A185_R GCTGACCTTGCTGTGCTG
Reviews

Customers who bought this product also purchased
A167
A167
A186
A186
A173
A173
A191
A191
A178
A178
A166
A166
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies