Top » Catalog » SNPs » Y2395

$18.00

Y2395
[Y2395]

Y2395
hg38 Position: ChrY:19032335..19032335
Ancestral: T
Derived: G
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Downstream R1a-Z282
Forward Primer: Y2395_F TTCCAATCCAAATAGACAGTGG
Reverse Primer: Y2395_R TTTCAGTGAGCCAAGACTGC
Reviews

Customers who bought this product also purchased
CTS6
CTS6
Y2630
Y2630
YP5480
YP5480
Z2125
Z2125
FGC18218
FGC18218
F1345
F1345
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies