Top » Catalog » SNPs » Z5017

$18.00

Z5017
[Z5017]

Z5017
hg38 Position: ChrY:26365592..26365592
Ancestral: G
Derived: A
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from CTS9320 parallel to Z5018
Forward Primer: Z5017_F AGTATACAGTTACAATTTTCTGTCCAATGA
Reverse Primer: Z5017_R CTACTGTGTTACACCGAGCCTG
Reviews

Customers who bought this product also purchased
BY159269
BY159269
BY189808
BY189808
Y129143
Y129143
Y128502
Y128502
BY157133
BY157133
Y128213
Y128213
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies