Top » Catalog » SNPs » A246

$18.00

A246
[A246]

A246
hg38 Position: ChrY:9807137..9807137
Ancestral: T
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A246_F ACTGTTCCACCCTGGACTTG
Reverse Primer: A246_R AGTGCTTCCTGCCATTATGC
Reviews

Customers who bought this product also purchased
A244
A244
A251
A251
A230
A230
A256
A256
A243
A243
A250
A250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies