Top » Catalog » SNPs » A252

$18.00

A252
[A252]

A252
hg38 Position: ChrY:16791788..16791788
Ancestral: T
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A252_F CAACCAACTCCAGTTTTGTAGC
Reverse Primer: A252_R GCATTTGTGCCATATTTAGCTG
Reviews

Customers who bought this product also purchased
A248
A248
A229
A229
A255
A255
A242
A242
Z251
Z251
A247
A247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies