Top » Catalog » Y SNPs » PH1501

$18.00

PH1501
[PH1501]

PH1501
hg38 Position: ChrY:12780474..12780474
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: PH1501_F GCGTTACCGCATCCTTACTC
Reverse Primer: PH1501_R CCATTCCAAGGCACTTCATC
Reviews

Customers who bought this product also purchased
Y212311
Y212311
ZS3820
ZS3820
ZS3844
ZS3844
ZS3833
ZS3833
BY174048
BY174048
FT345374
FT345374
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies