Top » Catalog » SNPs » A7025

$18.00

A7025
[A7025]

A7025
hg38 Position: ChrY:20360874..20360874
Ancestral: G
Derived: T
Reference: Vladimir Tagankin (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: A7025_F CACGAAGACATTCTCCAGTCAG
Reverse Primer: A7025_R GGGCAGTGGTGTGATTTCAG
Reviews

Customers who bought this product also purchased
A7017
A7017
A7022
A7022
A7015
A7015
A7021
A7021
YP1080
YP1080
A7020
A7020
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies