Top » Catalog » SNPs » rs2402130

$18.00

rs2402130
[rs2402130]

rs2402130
hg38 Position: Chr14:92334859..92334859
Ancestral: A
Derived: G
Reference: dbSNP
ISOGG Haplogroup: .
Comments: SLC24A4
Forward Primer: rs2402130v2_F AGACGTGAGGGTTTGAGTCC
Reverse Primer: rs2402130v2_R AGCACCTGCCTTCAGAGTTG
Reviews

Customers who bought this product also purchased
rs1805009
rs1805009
rs12913832
rs12913832
rs312262906
rs312262906
rs1042602
rs1042602
rs3114908
rs3114908
rs4959270
rs4959270
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies