Top » Catalog » SNPs » DF63

$18.00

DF63
[DF63]

DF63
hg38 Position: ChrY:3015945..3015945
Ancestral: T
Derived: C
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c2
Comments: Downstream R-L21
Forward Primer: DF63_F CATTGATTTACATACCTGCTGTCAC
Reverse Primer: DF63_R CCCAAAGTTATTTATAGATTCAATGCTG
Reviews

Customers who bought this product also purchased
A7907
A7907
Y14240
Y14240
BY20463
BY20463
DF27
DF27
Y18513
Y18513
Y18437
Y18437
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies