Top » Catalog » SNPs » A7729

$18.00

A7729
[A7729]

A7729
hg38 Position: ChrY:14762744..14762744
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: L161 subclade Isles C. Below A544
Forward Primer: A7729_F TAACTGTAGTGTAAACACGCTAATGC
Reverse Primer: A7729_R CTTCCAGCCAAATGAATAAACAC
Reviews

Customers who bought this product also purchased
FGC14463
FGC14463
Y3734
Y3734
FGC7174
FGC7174
FGC7126
FGC7126
CTS10228
CTS10228
FGC14457
FGC14457
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies