Top » Catalog » SNPs » A422

$18.00

A422
[A422]

A422
hg38 Position: ChrY:13595887..13595887
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > DF6 > A459
Forward Primer: A422_F CATAGTTTTTCACCTGGTGCG
Reverse Primer: A422_R GTGGCAACACTCATGATTATCG
Reviews

Customers who bought this product also purchased
A740
A740
DYS713
DYS713
A712
A712
A682
A682
A385
A385
A423
A423
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies