Top » Catalog » SNPs » A2062

$18.00

A2062
[A2062]

A2062
hg38 Position: ChrY:21307478..21307478
Ancestral: G
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 Z141+ Y6231+ Y6232+ Y6233+ [EE] Branch
Forward Primer: A2062_F GAGGACTACCTAAAAAACAGGGC
Reverse Primer: A2062_R AGCAGAGCTAAGCCCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies