Top » Catalog » SNPs » YP380

$18.00

YP380
[YP380]

YP380
hg38 Position: ChrY:19560400..19560400
Ancestral: A
Derived: C
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP380_F GGGCAAGACGGTTAGATCAG
Reverse Primer: YP380_R AGAGGAACCAACTTGGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies