Top » Catalog » SNPs » A6500

$18.00

A6500
[A6500]

A6500
hg38 Position: ChrY:20841990..20841990
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6500_F ACAAATTTATTTGCTTTTCTGTTGC
Reverse Primer: A6500_R AAACCACCGTGGCACATAC
Reviews

Customers who bought this product also purchased
A6503
A6503
R1b-S5488 Jamieson Panel
R1b-S5488 Jamieson Panel
A6495
A6495
A6502
A6502
A6490
A6490
A6501
A6501
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies