Top » Catalog » SNPs » F1092

$18.00

F1092
[F1092]

F1092
hg38 Position: ChrY:8200452..8200452
Ancestral: A
Derived: G
Reference: Yan Shi (2011)
ISOGG Haplogroup: R2a2a1a
Comments: Below M479 > M124 > FGC13188
Forward Primer: F1092_F GAGTCTCTACCAGAGAGTCCATTCAC
Reverse Primer: F1092_R ATCCATTCTCTAAAGGGGAACG
Reviews

Customers who bought this product also purchased
BY14642
BY14642
A692
A692
FGC13184
FGC13184
FGC12615
FGC12615
L295
L295
R2-M479 Panel
R2-M479 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies