Top » Catalog » SNPs » FGC5856

$18.00

FGC5856
[FGC5856]

FGC5856
HG19 Position: ChrY:3077221..3077221
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a R1b-M222 person
Forward Primer: FGC5856_F GACCTCTATAAGTTCTTACTTTGGTGCAT
Reverse Primer: FGC5856_R TATCTGTATAAATAGAAAATGTTTAGGTAAAGTG
Reviews

Customers who bought this product also purchased
A259
A259
DF13
DF13
A223
A223
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
L1335
L1335
Z253
Z253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies