Top » Catalog » SNPs » FGC5856

$18.00

FGC5856
[FGC5856]

FGC5856
HG19 Position: ChrY:3209180..3209180
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a R1b-M222 person
Forward Primer: FGC5856_F GACCTCTATAAGTTCTTACTTTGGTGCAT
Reverse Primer: FGC5856_R TATCTGTATAAATAGAAAATGTTTAGGTAAAGTG
Reviews

Customers who bought this product also purchased
Z253
Z253
DF21
DF21
L21
L21
A259
A259
DF13
DF13
A223
A223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies