Top » Catalog » SNPs » FGC7942

$18.00

FGC7942
[FGC7942]

FGC7942
hg38 Position: ChrY:15547386..15547389
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC6
Forward Primer: FGC7942v2_F TACTGTTCTTTCCGTGAGAAGCT
Reverse Primer: FGC7942v2_R GGTAGGAACAGTTATCTATTATCTCAATACAC
Reviews

Customers who bought this product also purchased
FGC19506
FGC19506
FGC4350
FGC4350
FGC4342
FGC4342
FGC4357
FGC4357
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies