Top » Catalog » SNPs » Z29764

$18.00

Z29764
[Z29764]

Z29764
hg38 Position: ChrY:17257342..17257342
Ancestral: A
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not lised)
Comments: Equiv to PH1631
Forward Primer: Z29764v2_F GGGGACAATTGAGTGGCTATC
Reverse Primer: Z29764v2_R GAGGATTGCTTGAGCCCAC
Reviews

Customers who bought this product also purchased
Z2105
Z2105
Z2109
Z2109
Y101118
Y101118
R1b-Z2103 Panel
R1b-Z2103 Panel
Y83965
Y83965
U152
U152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies