Top » Catalog » SNPs » Y11203

$18.00

Y11203
[Y11203]

Y11203
hg38 Position: ChrY:13815275..13815275
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: I1a (not listed)
Comments: Below S14887
Forward Primer: Y11203_F GAAAAACTTTCCCTTTACCCTCA
Reverse Primer: Y11203_R TTGTAAATGTAATATAACTTTCCATTTGC
Reviews

Customers who bought this product also purchased
CTS6868
CTS6868
CTS2208
CTS2208
L22
L22
Z140
Z140
Y29628
Y29628
Z59
Z59
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies