Top » Catalog » SNPs » A34107

$19.00

A34107
[A34107]

A34107
hg38 Position: ChrY:14316220..14316220
Ancestral: A
Derived: G
Reference: YSEQ (2022)
ISOGG Haplogroup: J1
Comments: Below FGC7393 > Y154840
Forward Primer: A34107_F AGAACCCACCAATTCCGG
Reverse Primer: A34107_R GAGAATAGCACAGGGAAGACTAGC
Reviews

Customers who bought this product also purchased
A34108
A34108
A34106
A34106
A34112
A34112
A34105
A34105
A34111
A34111
FT121549
FT121549
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies