Top » Catalog » SNPs » A34112

$19.00

A34112
[A34112]

A34112
hg38 Position: ChrY:20777074..20777074
Ancestral: A
Derived: G
Reference: YSEQ (2022)
ISOGG Haplogroup: J1
Comments: Below FGC7393 > Y154840
Forward Primer: A34112_F GGAGTGCAATGACCCAGC
Reverse Primer: A34112_R GCTAAGACCCTTCACAAGAATAACTG
Reviews

Customers who bought this product also purchased
A34107
A34107
A34106
A34106
A34111
A34111
A34105
A34105
A34110
A34110
FT121549
FT121549
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies