Top » Catalog » SNPs » Z16502

$18.00

Z16502
[Z16502]

Z16502
hg38 Position: ChrY:2831784..2831784
Ancestral: T
Derived: A
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1
Comments: Below DF13
Forward Primer: Z16502_F GAACGGCATTACATAACGGG
Reverse Primer: Z16502_R AACTTATTTTAACAATTATTTAGAGTTTTCAGTG
Reviews

Customers who bought this product also purchased
Y17438
Y17438
BY132127
BY132127
FGC61834
FGC61834
Y96923
Y96923
L1444
L1444
FGC61842
FGC61842
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies