Top » Catalog » SNPs » A10980

$18.00

A10980
[A10980]

A10980
hg38 Position: ChrY:2795422..2795422
Ancestral: G
Derived: A
Reference: Goff Blackburn (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > A494
Forward Primer: A10980_F GTGCAGCATTCTAGCCAACC
Reverse Primer: A10980_R CGTAATAGCTAGCCTATCCTACCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies