Top » Catalog » SNPs » FGC5441

$18.00

FGC5441
[FGC5441]

FGC5441
hg38 Position: ChrY:3023312..3023312
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Below FGC1
Forward Primer: FGC5441_F TCCCTCTGAAGACCTGGTAGG
Reverse Primer: FGC5441_R CTCCCTAGCCCTCCGTAAAC
Reviews

Customers who bought this product also purchased
FGC45019
FGC45019
FGC60202
FGC60202
ZS10480
ZS10480
FGC5454
FGC5454
FGC5451
FGC5451
FGC1696
FGC1696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies