Top » Catalog » SNPs » FGC6538

$18.00

FGC6538
[FGC6538]

FGC6538
hg38 Position: ChrY:17212220..17212220
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC6538_F CTTTTGGCTGTGGGTGACTC
Reverse Primer: FGC6538_R AGGTTCATGCCATTCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies