Top » Catalog » SNPs » PH2818

$18.00

PH2818
[PH2818]

PH2818
hg38 Position: ChrY:14970180..14970180
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: E1b1
Comments: Below V22 > CTS6080
Forward Primer: PH2818_F AACTTGAATTTGCTTTCTAATTTCTCC
Reverse Primer: PH2818_R GAGCTTTATGTGTGTATTTTGTTTAGTTG
Reviews

Customers who bought this product also purchased
BY7446
BY7446
CTS4089
CTS4089
Z834
Z834
FGC92599
FGC92599
Y133046
Y133046
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies