Top » Catalog » SNPs » ZS5613

$19.00

ZS5613
[ZS5613]

ZS5613
hg38 Position: ChrY:8539025..8539025
Ancestral: C
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC2. Found in Big Y sample M6758
Forward Primer: ZS5613_F TCTAGCTCCTGAGAACCAGAAACTAC
Reverse Primer: ZS5613_R TCTTTGTGACCACAAGCTGTG
Reviews

Customers who bought this product also purchased
FT197214
FT197214
FT102480
FT102480
ZS11278
ZS11278
ZS8988
ZS8988
A27207
A27207
ALK206
ALK206
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies