Top » Catalog » SNPs » BY4

$18.00

BY4
[BY4]

BY4
hg38 Position: ChrY:22300121..22300121
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC12 > FGC1695
Forward Primer: BY4_F ATCTCTTATCTGGGTAAGGGTCAG
Reverse Primer: BY4_R CTTGTCTCGAACTCCTGACATG
Reviews

Customers who bought this product also purchased
FGC19909
FGC19909
M5649
M5649
ZS241
ZS241
CTS11741
CTS11741
Z2324
Z2324
PF4881
PF4881
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies