Top » Catalog » SNPs » FGC32805

$18.00

FGC32805
[FGC32805]

FGC32805
hg38 Position: ChrY:16870946..16870946
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of M222
Forward Primer: FGC32805_F TGAACGATAGGTTGAAGATATTTTGAG
Reverse Primer: FGC32805_R TGCTATGGAAACAGTCCTAATTATCC
Reviews

Customers who bought this product also purchased
A3
A3
DF13
DF13
L513
L513
Z17816
Z17816
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies