Top » Catalog » SNPs » FGC13203

$18.00

FGC13203
[FGC13203]

FGC13203
hg38 Position: ChrY:12025415..12025415
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R2a2a
Comments: Below M479 > M124 > P267
Forward Primer: FGC13203_F CACAGTAGTGTTAAATTGTTTAAGCAAAC
Reverse Primer: FGC13203_R CCTTCCAGCTTAGCCTCCTC
Reviews

Customers who bought this product also purchased
BY14642
BY14642
A692
A692
FGC13184
FGC13184
FGC12615
FGC12615
L295
L295
R2-M479 Panel
R2-M479 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies