Top » Catalog » SNPs » FGC1705

$18.00

FGC1705
[FGC1705]

FGC1705
hg38 Position: ChrY:8002842..8002842
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-L222.2
Comments: Phyloequivalent to J1-L222.2
Forward Primer: FGC1705_F CAGCCACATGTCACATTTCC
Reverse Primer: FGC1705_R AAAGCCCTTGGATGTTTTTG
Reviews

Customers who bought this product also purchased
ZS9061
ZS9061
FGC10591
FGC10591
FGC29838
FGC29838
FGC10592
FGC10592
FGC10599
FGC10599
A10526
A10526
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies