Top » Catalog » SNPs » ZS11666

$18.00

ZS11666
[ZS11666]

ZS11666
hg38 Position: ChrY:6851703..6851703
Ancestral: T
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream ZS5804
Forward Primer: ZS11666_F GATTTAAGTGTGATTTGTCAAGGC
Reverse Primer: ZS11666_R CAAGACTTTTTAAAAGAGTACAATATAGTAGAAG
Reviews

Customers who bought this product also purchased
ZS11617
ZS11617
ZS5814
ZS5814
FGC1715
FGC1715
FGC40709
FGC40709
FGC1713
FGC1713
A19335
A19335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies