Top » Catalog » SNPs » CTS3859

$18.00

CTS3859
[CTS3859]

CTS3859
hg38 Position: ChrY:13117078..13117078
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3859_F CTGTCTGCCATCACCCG
Reverse Primer: CTS3859_R TTTTTAGTAGCTGTTTGAGTGTCCAG
Reviews

Customers who bought this product also purchased
FGC7393
FGC7393
ZS9192
ZS9192
FGC5
FGC5
FGC1
FGC1
FGC22745
FGC22745
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies