Top » Catalog » SNPs » CTS3119

$18.00

CTS3119
[CTS3119]

CTS3119
hg38 Position: ChrY:12560027..12560027
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b (not listed)
Comments: Below U175 > U209 > M4232 > Z1720 > M4041 > Z1788
Forward Primer: CTS3119_F TGTATAGAATGATTGGTGATGACCC
Reverse Primer: CTS3119_R CCTCAAACCGCCATCCTG
Reviews

Customers who bought this product also purchased
M4231
M4231
Z1720
Z1720
M96
M96
CTS4361
CTS4361
CTS11248
CTS11248
U290
U290
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies