Top » Catalog » SNPs » Y22259

$19.00

Y22259
[Y22259]

Y22259
hg38 Position: ChrY:15311948..15311948
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below M458 > L1029 > YP263
Forward Primer: Y22259_F ATTGCTAAAGCTTCACTGCAGTAG
Reverse Primer: Y22259_R CACTTATTGGAGTCTTCCCCG
Reviews

Customers who bought this product also purchased
MF66771
MF66771
FTA65391
FTA65391
Y2912
Y2912
BY122089
BY122089
FGC72548
FGC72548
F25330
F25330
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies