Top » Catalog » SNPs » FGC23227

$18.00

FGC23227
[FGC23227]

FGC23227
hg38 Position: ChrY:20565001..20565015
Ancestral: del
Derived: ins
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23227_F CTAGAATTTTACATCTGGCCAAATG
Reverse Primer: FGC23227_R TCAGCCTATATGTGTCTTTGCC
Reviews

Customers who bought this product also purchased
FGC23207
FGC23207
DYS617
DYS617
FGC23198
FGC23198
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies